Skip to content

Raghuboi/codonforge

Repository files navigation

CodonForge

Research preview: clean-room Rust CLI for protein-faithful mRNA coding-sequence optimization. Not suitable for production mRNA design or clinical use.

Rust License: MIT CI

CodonForge reads a protein sequence and generates a synonymous mRNA sequence. It supports:

  • greedy: v0 highest-frequency human codon baseline
  • beam: v1 deterministic beam search balancing CAI, GC%, U%, and adjacent-repeat penalty

It computes Codon Adaptation Index (CAI), reports simple composition metrics, and writes mRNA FASTA for downstream benchmarking.

CodonForge is intentionally small. It is useful as a deterministic baseline, benchmark integration point, and reproducible research tool, not as a complete mRNA design system.

What this is not

CodonForge does not implement:

  • LinearDesign algorithm parity
  • O(N³) codon-constrained folding dynamic programming
  • Turner energy secondary-structure scoring
  • internal MFE prediction
  • GPU acceleration
  • UTR design
  • clinical or therapeutic recommendations

Minimum free energy (MFE), structure-aware metrics, and downstream biological scores should be computed by external benchmark tools such as ViennaRNA-backed evaluators.

Install

From source

git clone https://github.com/raghuboi/codonforge.git
cd codonforge
cargo build --release

The binary will be at:

target/release/codonforge

From crates.io

CodonForge is not published to crates.io yet. Until the first crates.io release is published, use the source checkout path above.

Quickstart

From a source checkout:

echo "MNDTEAI" | cargo run --release --

Expected output shape:

Input protein: MNDTEAI
mRNA sequence:  AUGAACGACACCGAGGCCAUC
mRNA structure: .....................
mRNA folding free energy: nan kcal/mol; mRNA CAI: 1.000
CodonForge strategy: greedy; GC%: 57.14; U%: 9.52; repeat penalty: 4.0
Runtime: 0.0000 seconds

Runtime varies by machine.

Usage

Protein sequence from stdin

echo "MNDTEAI" | codonforge

From a source checkout, use:

echo "MNDTEAI" | cargo run --release --

Protein FASTA input

codonforge --input path/to/protein.fasta

Write pure mRNA FASTA

codonforge \
  --input path/to/protein.fasta \
  --fasta-out path/to/output.fasta

Beam search

codonforge \
  --input path/to/protein.fasta \
  --strategy beam \
  --beam-width 32 \
  --target-gc 55 \
  --target-u 20

Beam-search objective:

score =
  + weight_cai * mean_log_cai_score
  - weight_gc * abs(GC% - target_gc)
  - weight_u * abs(U% - target_u)
  - weight_repeat * adjacent_repeat_penalty

The default weights are conservative and CPU-only. Increase GC/U weights when exploring composition realism; keep greedy as the baseline for comparisons.

Custom codon usage table

codonforge \
  --input path/to/protein.fasta \
  --codonusage path/to/codon_table.csv

Codon usage tables must contain three columns:

codon,amino_acid,frequency

Codons may use RNA U or DNA T notation. DNA notation is normalized to RNA.

CLI flags

Flag Description
-i, --input <FILE> Input protein FASTA file path. If omitted, CodonForge reads a plain protein sequence from stdin.
-f, --fasta-out <FILE> Output pure mRNA FASTA file path.
-c, --codonusage <FILE> Codon usage table CSV path. Default: data/codon_usage_freq_table_human.csv.
`--strategy <greedy beam>`
--beam-width <N> Beam width for --strategy beam. Default: 32.
--target-gc <PERCENT> Target GC percentage for beam search. Default: 55.
--target-u <PERCENT> Target U percentage for beam search. Default: 20.
--weight-cai <FLOAT> CAI objective weight for beam search. Default: 1.0.
--weight-gc <FLOAT> GC target penalty weight. Default: 0.02.
--weight-u <FLOAT> U target penalty weight. Default: 0.01.
--weight-repeat <FLOAT> Adjacent-repeat penalty weight. Default: 0.05.
-l, --lambda <FLOAT> Deprecated LinearDesign-style structure parameter; accepted for compatibility and ignored with a warning.
-v, --verbose Print diagnostic information to stderr.
-h, --help Print help.

Examples

Toy example

cargo build --release
./examples/toy/run.sh

RP mini-benchmark

cargo build --release
./examples/benchmark/run.sh

The mini-benchmark runs RHO, PRPF31, RPE65, and RPGR-ORF15 with both greedy and beam strategies. It is included for reproducible computational experiments only.

Data provenance

The bundled human codon usage table is derived from the Kazusa Codon Usage Database Homo sapiens record:

Frequencies in data/codon_usage_freq_table_human.csv are normalized from Kazusa raw counts within each amino-acid family. See data/README.md for conversion notes.

Development

Run the full local gate:

cargo fmt --check
cargo test
cargo clippy --all-targets --all-features -- -D warnings
cargo doc --no-deps
cargo publish --dry-run

Research use and citation

If you use CodonForge in research, cite the repository and include the exact git commit, CodonForge version, codon usage table source, and benchmark scripts used.

Citation metadata is provided in CITATION.cff.

Limitations

  • CAI depends on the selected codon usage table; compare tools only when using the same table.
  • Beam search is a simple multi-objective heuristic, not a folding-aware optimizer.
  • mRNA folding free energy: nan is a compatibility placeholder; CodonForge does not compute MFE.
  • Composition metrics are useful for screening and benchmarking, not evidence of biological efficacy.

License

MIT. See LICENSE.

About

Clean-room Rust CLI for protein-faithful mRNA codon optimization research

Topics

Resources

License

Code of conduct

Contributing

Security policy

Stars

0 stars

Watchers

0 watching

Forks

Packages

 
 
 

Contributors