-
Notifications
You must be signed in to change notification settings - Fork 4
Installed the fasta_classify_catpack subworkflow #38
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
Merged
KateSakharova
merged 4 commits into
dev
from
feature/catpack-for-metagenomic-taxa-classification
Mar 16, 2026
Merged
Changes from all commits
Commits
Show all changes
4 commits
Select commit
Hold shift + click to select a range
File filter
Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
There are no files selected for viewing
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,7 @@ | ||
| process { | ||
| resourceLimits = [ | ||
| cpus: 2, | ||
| memory: '15.GB', | ||
| time: '1.h' | ||
| ] | ||
| } |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,5 @@ | ||
| --- | ||
| channels: | ||
| - conda-forge | ||
| dependencies: | ||
| - "conda-forge::gzip" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,29 @@ | ||
| process RENAME_FASTA_FOR_CATPACK { | ||
| tag "${meta.id}" | ||
|
|
||
| input: | ||
| tuple val(meta), path(fasta) | ||
|
|
||
| output: | ||
| tuple val(meta), path("output/*.fasta"), emit: renamed_fasta | ||
|
|
||
| script: | ||
| def is_compressed = fasta.name.endsWith('.gz') | ||
| extension = '.fasta' | ||
| def base = fasta.name | ||
| .replaceAll(/\.gz$/, '') | ||
| .replaceAll(/\.(fa|fasta|fna)$/, '') | ||
| def output_name = base + extension | ||
|
|
||
| if (is_compressed) { | ||
| """ | ||
| mkdir -p output | ||
| gunzip -c ${fasta} > output/${output_name} | ||
| """ | ||
| } else { | ||
| """ | ||
| mkdir -p output | ||
| ln -s ../${fasta} output/${output_name} | ||
| """ | ||
| } | ||
| } | ||
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,47 @@ | ||
| name: "rename_fasta_for_catpack" | ||
| description: | | ||
| Renames a FASTA file (stripping the original extension and using .fasta) for compatibility with CAT/BAT (CATpack). Compressed inputs are decompressed; uncompressed inputs are symlinked. | ||
| keywords: | ||
| - fasta | ||
| - rename | ||
| - catpack | ||
| - cat | ||
| tools: | ||
| - "gzip": | ||
| description: "Standard compression/decompression utility, used here to decompress .gz FASTA files." | ||
| homepage: "https://www.gnu.org/software/gzip/" | ||
| documentation: "https://www.gnu.org/software/gzip/manual/" | ||
| licence: ["GPL-3.0-or-later"] | ||
| identifier: null | ||
|
|
||
| input: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information. | ||
| e.g. `[ id:'sample1' ]` | ||
| - fasta: | ||
| type: file | ||
| description: | | ||
| FASTA file (compressed .gz or uncompressed). Any of .fa, .fna, or .fasta extensions are accepted. | ||
| pattern: "*.{fa,fna,fasta,fa.gz,fna.gz,fasta.gz}" | ||
|
|
||
| output: | ||
| renamed_fasta: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information. | ||
| e.g. `[ id:'sample1' ]` | ||
| - "output/*.fasta{,.gz}": | ||
| type: file | ||
| description: | | ||
| Renamed FASTA file with a .fasta extension, decompressed if the input was compressed. | ||
| pattern: "output/*.fasta" | ||
|
|
||
| authors: | ||
| - "@KateSakharova" | ||
| - "@ochkalova" | ||
| maintainers: | ||
| - "@KateSakharova" | ||
| - "@ochkalova" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,60 @@ | ||
| nextflow_process { | ||
|
|
||
| name "Test Process RENAME_FASTA_FOR_CATPACK" | ||
| script "../main.nf" | ||
| process "RENAME_FASTA_FOR_CATPACK" | ||
|
|
||
| tag "modules" | ||
| tag "rename_fasta_for_catpack" | ||
|
|
||
| test("RENAME_FASTA_FOR_CATPACK - uncompressed fasta") { | ||
|
|
||
| when { | ||
| process { | ||
| """ | ||
| input[0] = [ | ||
| [ id: 'test' ], | ||
| file("${moduleDir}/tests/test.fasta", checkIfExists: true) | ||
| ] | ||
| """ | ||
| } | ||
| } | ||
|
|
||
| then { | ||
| assertAll( | ||
| { assert process.success }, | ||
| { assert process.out.renamed_fasta.size() == 1 }, | ||
| { assert process.out.renamed_fasta[0][1].toString().endsWith(".fasta") }, | ||
| { assert snapshot(process.out).match() } | ||
| ) | ||
| } | ||
|
|
||
| } | ||
|
|
||
| test("RENAME_FASTA_FOR_CATPACK - compressed fasta") { | ||
|
|
||
| when { | ||
| process { | ||
| """ | ||
| input[0] = [ | ||
| [ id: 'test_compressed' ], | ||
| file("${moduleDir}/tests/test_compressed.fa.gz", checkIfExists: true) | ||
| ] | ||
| """ | ||
| } | ||
| } | ||
|
|
||
| then { | ||
| assertAll( | ||
| { assert process.success }, | ||
| { assert process.out.renamed_fasta.size() == 1 }, | ||
| // compressed input should be decompressed and renamed to .fasta (not .fasta.gz) | ||
| { assert process.out.renamed_fasta[0][1].toString().endsWith(".fasta") }, | ||
| { assert !process.out.renamed_fasta[0][1].toString().endsWith(".fa.fasta") }, | ||
| { assert snapshot(process.out).match() } | ||
| ) | ||
| } | ||
|
|
||
| } | ||
|
|
||
| } |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,4 @@ | ||
| >contig_1 | ||
| ATGCATGCATGCATGCATGC | ||
| >contig_2 | ||
| TTTTGGGGCCCCAAAAT |
Binary file not shown.
Some generated files are not rendered by default. Learn more about how customized files appear on GitHub.
Oops, something went wrong.
Some generated files are not rendered by default. Learn more about how customized files appear on GitHub.
Oops, something went wrong.
Some generated files are not rendered by default. Learn more about how customized files appear on GitHub.
Oops, something went wrong.
Oops, something went wrong.
Oops, something went wrong.
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
wow, nextflow magic