Installed the fasta_classify_catpack subworkflow

conf/modules.config

@@ -18,10 +18,29 @@ process {
         saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
     ]
 
+    withName: 'CATPACK_ADDNAMES_BINS' {
+        ext.args = '--only_official'
+        publishDir = [
+            path: { "${params.outdir}/${params.mode}/taxonomy" },
+            mode: params.publish_dir_mode,
+            pattern: "*.txt",
+            saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+        ]
+    }
+
+    withName: 'CHECKM2_PREDICT' {
+        publishDir = [
+            path: { "${params.outdir}/${params.mode}/checkm2" },
+            mode: params.publish_dir_mode,
+            pattern: "*_checkm2_report.tsv",
+            saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
+        ]
+    }
+
     withName: 'COVERM_GENOME' {
         ext.args = '--min-covered-fraction 0 --methods mean'
         publishDir = [
-            path: { "${params.outdir}/coverage" },
+            path: { "${params.outdir}/${params.mode}/coverage" },
             mode: params.publish_dir_mode,
             saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
         ]

conf/test.config

@@ -0,0 +1,7 @@
+process {
+    resourceLimits = [
+        cpus: 2,
+        memory: '15.GB',
+        time: '1.h'
+    ]
+}

modules.json

@@ -10,6 +10,36 @@
                         "git_sha": "41dfa3f7c0ffabb96a6a813fe321c6d1cc5b6e46",
                         "installed_by": ["modules"]
                     },
+                    "catpack/addnames": {
+                        "branch": "master",
+                        "git_sha": "1100099613c12e944931426f46f10b14c4a74b3d",
+                        "installed_by": ["fasta_classify_catpack"]
+                    },
+                    "catpack/bins": {
+                        "branch": "master",
+                        "git_sha": "1100099613c12e944931426f46f10b14c4a74b3d",
+                        "installed_by": ["fasta_classify_catpack"]
+                    },
+                    "catpack/contigs": {
+                        "branch": "master",
+                        "git_sha": "1100099613c12e944931426f46f10b14c4a74b3d",
+                        "installed_by": ["fasta_classify_catpack"]
+                    },
+                    "catpack/download": {
+                        "branch": "master",
+                        "git_sha": "1100099613c12e944931426f46f10b14c4a74b3d",
+                        "installed_by": ["fasta_classify_catpack"]
+                    },
+                    "catpack/prepare": {
+                        "branch": "master",
+                        "git_sha": "1100099613c12e944931426f46f10b14c4a74b3d",
+                        "installed_by": ["fasta_classify_catpack"]
+                    },
+                    "catpack/summarise": {
+                        "branch": "master",
+                        "git_sha": "1100099613c12e944931426f46f10b14c4a74b3d",
+                        "installed_by": ["fasta_classify_catpack"]
+                    },
                     "checkm2/databasedownload": {
                         "branch": "master",
                         "git_sha": "81470b59ebadb3d01dcfcd37d44f88eb890f4851",
@@ -45,11 +75,22 @@
                         "branch": "master",
                         "git_sha": "41dfa3f7c0ffabb96a6a813fe321c6d1cc5b6e46",
                         "installed_by": ["modules"]
+                    },
+                    "untar": {
+                        "branch": "master",
+                        "git_sha": "447f7bc0fa41dfc2400c8cad4c0291880dc060cf",
+                        "installed_by": ["fasta_classify_catpack"]
                     }
                 }
             },
             "subworkflows": {
                 "nf-core": {
+                    "fasta_classify_catpack": {
+                        "branch": "master",
+                        "git_sha": "1e1d30d328949507ee5af79b7ff58b09738b8227",
+                        "installed_by": ["subworkflows"],
+                        "patch": "subworkflows/nf-core/fasta_classify_catpack/fasta_classify_catpack.diff"
+                    },
                     "utils_nextflow_pipeline": {
                         "branch": "master",
                         "git_sha": "05954dab2ff481bcb999f24455da29a5828af08d",

modules/local/rename_fasta_for_catpack/environment.yml

@@ -0,0 +1,5 @@
+---
+channels:
+  - conda-forge
+dependencies:
+  - "conda-forge::gzip"

modules/local/rename_fasta_for_catpack/main.nf

@@ -0,0 +1,29 @@
+process RENAME_FASTA_FOR_CATPACK {
+    tag "${meta.id}"
+
+    input:
+    tuple val(meta), path(fasta)
+
+    output:
+    tuple val(meta), path("output/*.fasta"), emit: renamed_fasta
+
+    script:
+        def is_compressed = fasta.name.endsWith('.gz')
+        extension = '.fasta'
+        def base = fasta.name
+            .replaceAll(/\.gz$/, '')
+            .replaceAll(/\.(fa|fasta|fna)$/, '')
+        def output_name = base + extension
+
+        if (is_compressed) {
+            """
+            mkdir -p output
+            gunzip -c ${fasta} > output/${output_name}
+            """
+        } else {
+            """
+            mkdir -p output
+            ln -s ../${fasta} output/${output_name}
+            """
+        }
+}

modules/local/rename_fasta_for_catpack/meta.yml

@@ -0,0 +1,47 @@
+name: "rename_fasta_for_catpack"
+description: |
+  Renames a FASTA file (stripping the original extension and using .fasta) for compatibility with CAT/BAT (CATpack). Compressed inputs are decompressed; uncompressed inputs are symlinked.
+keywords:
+  - fasta
+  - rename
+  - catpack
+  - cat
+tools:
+  - "gzip":
+      description: "Standard compression/decompression utility, used here to decompress .gz FASTA files."
+      homepage: "https://www.gnu.org/software/gzip/"
+      documentation: "https://www.gnu.org/software/gzip/manual/"
+      licence: ["GPL-3.0-or-later"]
+      identifier: null
+
+input:
+  - - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information.
+          e.g. `[ id:'sample1' ]`
+    - fasta:
+        type: file
+        description: |
+          FASTA file (compressed .gz or uncompressed). Any of .fa, .fna, or .fasta extensions are accepted.
+        pattern: "*.{fa,fna,fasta,fa.gz,fna.gz,fasta.gz}"
+
+output:
+  renamed_fasta:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information.
+            e.g. `[ id:'sample1' ]`
+      - "output/*.fasta{,.gz}":
+          type: file
+          description: |
+            Renamed FASTA file with a .fasta extension, decompressed if the input was compressed.
+          pattern: "output/*.fasta"
+
+authors:
+  - "@KateSakharova"
+  - "@ochkalova"
+maintainers:
+  - "@KateSakharova"
+  - "@ochkalova"

modules/local/rename_fasta_for_catpack/tests/main.nf.test

@@ -0,0 +1,60 @@
+nextflow_process {
+
+    name "Test Process RENAME_FASTA_FOR_CATPACK"
+    script "../main.nf"
+    process "RENAME_FASTA_FOR_CATPACK"
+
+    tag "modules"
+    tag "rename_fasta_for_catpack"
+
+    test("RENAME_FASTA_FOR_CATPACK - uncompressed fasta") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id: 'test' ],
+                    file("${moduleDir}/tests/test.fasta", checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert process.out.renamed_fasta.size() == 1 },
+                { assert process.out.renamed_fasta[0][1].toString().endsWith(".fasta") },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("RENAME_FASTA_FOR_CATPACK - compressed fasta") {
+
+        when {
+            process {
+                """
+                input[0] = [
+                    [ id: 'test_compressed' ],
+                    file("${moduleDir}/tests/test_compressed.fa.gz", checkIfExists: true)
+                ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert process.out.renamed_fasta.size() == 1 },
+                // compressed input should be decompressed and renamed to .fasta (not .fasta.gz)
+                { assert process.out.renamed_fasta[0][1].toString().endsWith(".fasta") },
+                { assert !process.out.renamed_fasta[0][1].toString().endsWith(".fa.fasta") },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+}

modules/local/rename_fasta_for_catpack/tests/test.fasta

@@ -0,0 +1,4 @@
+>contig_1
+ATGCATGCATGCATGCATGC
+>contig_2
+TTTTGGGGCCCCAAAAT